Embedded Files
Who Stole The Erie Bell?!
Who Stole The Erie Bell?!
One of the people in this line up has done the unthinkable! They have stolen the Erie Bell! It is now up to you Middies to figure out which one of them is responsible and bring them to justice!
Different types of evidence has been left behind by the perpetrator and it is up to you to get the training you need to correctly analyze it you you can bring the thief to justice! Join the Middie CSI classes to get your training before moving on to analyzing the evidence below! Each type of evidence you successfully analyze will give you a clue about the line up for a total of 5 clues. Use all the clues to figure out the order of the line up and which person is the thief!
Fingerprint Evidence
Fingerprint Evidence
Identify the minutiae in the fingerprint to complete the clue!
Clue #1: Bill is _____________________________________
a: Enclosure
d: island
e: Bifurcation
m: spur
n: ridge ending
o: delta
t: crossover
Analyze The Blood Typing
Analyze The Blood Typing
Use the blood types to complete the clue by figuring out one of the persons names:
Clue#2: _________ is next to the perpetrator
Blood Spatter
Blood Spatter
Trace the spatter back to its origin
Trace the spatter back to its origin
And then unscramble the clues to complete the hint:
Clue #3: _(name)__ is _(#)__ away from the perpetrator
DNA Profiling
DNA Profiling
Restriction Enzymes cut strands of DNA up at certain locations. For example, one enzyme my look to find where ever there is a 'GC' in the DNA and cut after the G and before the C (TCGCATA--> 2 fragments TCG / CATA ). These fragments are then separated by gel electrophoresis based on how many base pairs each fragment has (TCG = 3bp, CATA = 4bp). Use the evidence and the results to complete the clues!
Evidence #4: Anywhere there is a 'GC', cut between the G and the C and look for the results on the gel electrophoresis
TAAGTCGGCTTGCAGCGTAC
Clue # 4: _________ is in the middle of the line up
Evidence #5: Anywhere there is a 'GC', cut between the G and the C and look for the results on the gel electrophoresis
ACCGCGCCCGATTGCGACTT
Clue # 5: ___________ is to the left of the perpetrator
Have all 5 clues? Then earn your badge and solve the case!
Have all 5 clues? Then earn your badge and solve the case!
Google Sites
Report abuse